Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA_100782 | |||
Gene | n/a | Organism | Mouse |
Genome Locus | chr11:33307958-33309057:+ | Build | n/a |
Disease | Pancreatic Ductal Adenocarcinoma | ICD-10 | Malignant neoplasm of Pancreatic duct (C25.3) |
DBLink | Link to database | PMID | 29255366 |
Experimental Method | |||
Sample Type | PDAC Tissues | Comparison | The Pancreatic ductal adenocarcinoma (PDAC) cell lines BxPC3 and normal Pancreatic cell lines |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TATGTTGGTGGATCCTGTTCGGCA ReverseTGGTGGGTAGACCAAGACTTGTGA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Chen, G, Shi, Y, Zhang, Y, Sun, J (2017). CircRNA_100782 regulates pancreatic carcinoma proliferation through the IL6-STAT3 pathway. Onco Targets Ther, 10:5783-5794. |